Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.146191 |
Chromosome: | chromosome 3 |
Location: | 1173413 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g149400 | RWP11 | (1 of 1) IPR003035//IPR011989//IPR016181 - RWP-RK domain // Armadillo-like helical // Acyl-CoA N-acyltransferase; RWP-RK transcription factor | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCGACTGCCGCACACGTTCTATACGGG |
Internal bar code: | CTGTCGTCGTTGCGCGGTCGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 315 |
LEAP-Seq percent confirming: | 99.5753 |
LEAP-Seq n confirming: | 2579 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGAGCATCGGGTAAGAACC |
Suggested primer 2: | TTAGCCAGCTCGGAGTGAGT |