Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.146221 |
Chromosome: | chromosome 6 |
Location: | 6384069 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g292249 | PHC50 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGATCATCGTGCCTGCCGGCTTCGACTGG |
Internal bar code: | ATGCGTTGTTCGCAGTTTCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 606 |
LEAP-Seq percent confirming: | 18.9376 |
LEAP-Seq n confirming: | 164 |
LEAP-Seq n nonconfirming: | 702 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGGAGTGGATTGAGATTA |
Suggested primer 2: | GTAGGTTGGCCTGCCAGTT |