| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.146251 |
| Chromosome: | chromosome 13 |
| Location: | 2991336 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g584200 | GRL1 | Glutaredoxin-like protein; (1 of 1) PF03595 - Voltage-dependent anion channel (SLAC1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGATCGGGTTGCGGGCGTCTACGAGTTC |
| Internal bar code: | GAAGTGGTGGGAAAACTGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 979 |
| LEAP-Seq percent confirming: | 99.261 |
| LEAP-Seq n confirming: | 26191 |
| LEAP-Seq n nonconfirming: | 195 |
| LEAP-Seq n unique pos: | 171 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACACAGTACCCCACCTCT |
| Suggested primer 2: | TTGTGGGTGTGCACTTGAAT |