| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146254 |
| Chromosome: | chromosome 3 |
| Location: | 4315064 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174850 | CGL111 | (1 of 1) PTHR19308:SF8 - STAR-RELATED LIPID TRANSFER PROTEIN 7, MITOCHONDRIAL; lipid-binding START protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACTTTGACGACGACTTCCGCCCCAAATG |
| Internal bar code: | GGACATCCGAAACAACGGGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 729 |
| LEAP-Seq percent confirming: | 99.6896 |
| LEAP-Seq n confirming: | 3854 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACTAGCTGGGCCCTCTT |
| Suggested primer 2: | GACGTCCATCTTCACCACCT |