| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146276 |
| Chromosome: | chromosome 1 |
| Location: | 3987006 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025950 | PPR8 | (1 of 1) IPR000209//IPR002885 - Peptidase S8/S53 domain // Pentatricopeptide repeat; PentatricoPeptide Repeat protein 8 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATTTAGCACTACTGCTGCTCTGCTCAA |
| Internal bar code: | GAAGGATTAGGGCCAGGGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 568 |
| LEAP-Seq percent confirming: | 70.9508 |
| LEAP-Seq n confirming: | 2164 |
| LEAP-Seq n nonconfirming: | 886 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAACGCTTTGGTCGTTTGG |
| Suggested primer 2: | GCTGTGCTGACGTGATGACT |