| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146298 |
| Chromosome: | chromosome 2 |
| Location: | 3311956 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095087 | (1 of 2) 3.4.14.1 - Dipeptidyl-peptidase I / Dipeptidyl transferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCTGTGTGGGATTGTGTGCTGTGCGG |
| Internal bar code: | GCGATAACACGGGTGAGATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 753 |
| LEAP-Seq percent confirming: | 99.0895 |
| LEAP-Seq n confirming: | 653 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTACTATCGCCGGTCCCTT |
| Suggested primer 2: | CAGCATCGTCAAGAACAGGA |