Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.146331 |
Chromosome: | chromosome 9 |
Location: | 3225791 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387689 | FAP76,CCDC180 | Flagellar Associated Protein 76; (1 of 1) PTHR21444//PTHR21444:SF14 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 180 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACCTCGTTTGCTTGGGTGAGCTACCC |
Internal bar code: | GGCCGTACGTTTCACAAGGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 531 |
LEAP-Seq percent confirming: | 99.2806 |
LEAP-Seq n confirming: | 138 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGGGGTGCAGATGACTAGC |
Suggested primer 2: | AGAGGAGTAGGCGGAGGAAG |