| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146407 |
| Chromosome: | chromosome 7 |
| Location: | 3818318 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338550 | (1 of 1) IPR002048//IPR006585//IPR006652//IPR008979//IPR011043//IPR011050 - EF-hand domain // Fucolectin tachylectin-4 pentraxin-1 // Kelch repeat type 1 // Galactose-binding domain-like // Galactose oxidase/kelch, beta-propeller // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACTGTCCTGGTGTCGGTGCGGTGTGTGT |
| Internal bar code: | AGCGGCGCGTTGAGCGCCACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 110 |
| LEAP-Seq percent confirming: | 52.5122 |
| LEAP-Seq n confirming: | 2362 |
| LEAP-Seq n nonconfirming: | 2136 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATGGTGTCCAGTAGCAG |
| Suggested primer 2: | GGGTATTCGGACATCCAGTG |