Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.146486 |
Chromosome: | chromosome 3 |
Location: | 1477493 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g151550 | (1 of 1) IPR000104//IPR029060 - Antifreeze protein, type I // PIN domain-like | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCAGTGGTGACTTGAGCGCCTGGAAGA |
Internal bar code: | ACTGGTGATCTTCGGGGCTATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 269 |
LEAP-Seq percent confirming: | 99.9293 |
LEAP-Seq n confirming: | 1414 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCTGTTGTTGCTGCTGAT |
Suggested primer 2: | TGTTGACGCATCTCTTTTCG |