| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146562 |
| Chromosome: | chromosome 2 |
| Location: | 6593919 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g117200 | Putative beta-galactosidase; (1 of 5) 3.2.1.23 - Beta-galactosidase / Lactase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATACCTGGCAGCGGGCGGATATGCCAGG |
| Internal bar code: | TGCTGAAATCAGCGTACGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 587 |
| LEAP-Seq percent confirming: | 93.6096 |
| LEAP-Seq n confirming: | 2959 |
| LEAP-Seq n nonconfirming: | 202 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | ACACATACACATGCGTGCCT |