Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.146608 |
Chromosome: | chromosome 9 |
Location: | 6833364 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g409750 | CAX2 | (1 of 3) K07300 - Ca2+:H+ antiporter (chaA, CAX); CAX family cation antiporter, membrane protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGAGGAATGCGATACATCGGAGAACTG |
Internal bar code: | TGCCTTGTGGGTCATCGCAAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 529 |
LEAP-Seq percent confirming: | 99.4558 |
LEAP-Seq n confirming: | 731 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCGATACGAGAAGACATGA |
Suggested primer 2: | CCTCCAACACTCTAGCCAGC |