Insertion junction: LMJ.RY0402.146642_2


Insertion cassette:CIB1
Side of cassette:3'
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CCGTACGCTCGTCACCGTACGACAGAGATC

Confirmation - LEAP-Seq

LEAP-Seq distance:917
LEAP-Seq percent confirming:99.8752
LEAP-Seq n confirming:800
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR