| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.146653 |
| Chromosome: | chromosome 4 |
| Location: | 1239064 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215250 | FAP26 | Ankyrin Repeat Flagellar Associated Protein 26; (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCATACCTCTTGACTTACTGAATAAACC |
| Internal bar code: | ATGAGGAGGAAGATAAGTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1144 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTGGGTATGACATCGTG |
| Suggested primer 2: | GCTGCAGACGTGATAGTCCA |