| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146666 |
| Chromosome: | chromosome 16 |
| Location: | 4673528 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687301 | SRH26 | (1 of 1) K15192 - TATA-binding protein-associated factor [EC:3.6.4.-] (BTAF1, MOT1); SNF2-related DNA/RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCTGCCAACCCTGCTACGACATGAGTAT |
| Internal bar code: | CTGAGGGGCTTCTTGCGAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 357 |
| LEAP-Seq percent confirming: | 97.455 |
| LEAP-Seq n confirming: | 2489 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACCCAGGTGAACATCA |
| Suggested primer 2: | CTCCATGCTTCCCTCTGAAG |