| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146839 |
| Chromosome: | chromosome 1 |
| Location: | 6884162 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g049826 | PHC59 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGTAGCAGGCTGTGACAAGGGCAGTCA |
| Internal bar code: | AGGAGGCACCTCGTCGTCCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 227 |
| LEAP-Seq percent confirming: | 69.9278 |
| LEAP-Seq n confirming: | 6390 |
| LEAP-Seq n nonconfirming: | 2748 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGTACTGCAAGGTGTGCC |
| Suggested primer 2: | CTAGGTGGCTGCGGTGAG |