Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.146855 |
Chromosome: | chromosome 14 |
Location: | 1869010 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g620600 | PHC2,FAP202 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 2 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCGTTAGTTTGGCGTGCGATGCAATCAT |
Internal bar code: | CTTCTCGTTGTTTTTACAAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 145 |
LEAP-Seq percent confirming: | 99.0826 |
LEAP-Seq n confirming: | 1728 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCATCAGCCACTTGTGAA |
Suggested primer 2: | GCCTTGGAGCAGCAGTAATC |