| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146906 |
| Chromosome: | chromosome 14 |
| Location: | 3644217 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631350 | VSP7 | (1 of 8) PTHR11339:SF290 - PROTEIN T26A8.1; Hydroxyproline-rich glycoprotein, presumed cell wall component | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGTAAAGCAACCCGCGTGCTGTTTTACA |
| Internal bar code: | GGGTAGACGTAACCGCTCGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 927 |
| LEAP-Seq percent confirming: | 99.6758 |
| LEAP-Seq n confirming: | 1230 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGGAGTTTGTGGTGGAG |
| Suggested primer 2: | ACACCTACCTCATCGTTGGC |