Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.146931 |
Chromosome: | chromosome 1 |
Location: | 6423702 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g045650 | ZNJ3 | DnaJ-like zinc-finger protein; (1 of 17) IPR001305 - Heat shock protein DnaJ, cysteine-rich domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCCTCCTGCTAGCGCGTCGCGCACAGG |
Internal bar code: | TCGGCCTCTTTTTAGACGATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 603 |
LEAP-Seq percent confirming: | 99.8052 |
LEAP-Seq n confirming: | 4098 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACCCGCTTACCTATCTCA |
Suggested primer 2: | CATGACTCGCCTTATGGGAT |