| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.146957 |
| Chromosome: | chromosome 9 |
| Location: | 3075311 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387100 | CGL12,PTST1 | (1 of 5) PTHR10343 - 5'-AMP-ACTIVATED PROTEIN KINASE , BETA SUBUNIT; Protein targeting to starch 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGCCGGGCCGCTACCGGGCCAAGTT |
| Internal bar code: | GGGCGTTCAGTCAGGTCCCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 922 |
| LEAP-Seq percent confirming: | 99.8065 |
| LEAP-Seq n confirming: | 3611 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTAGGAGACGCTGTCCG |
| Suggested primer 2: | CAGCTCAAAGTCAAAAGGGC |