| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.146969 |
| Chromosome: | chromosome 6 |
| Location: | 6239851 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g290800 | RMG1 | RNA cap guanine-N2 methyltransferase; (1 of 1) 2.3.1.221 - Noranthrone synthase / Polyketide synthase A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACGACCCAACAGTTTCCTTTGGACAATG |
| Internal bar code: | GTTTTGAGTGAATGCGAGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 99.712 |
| LEAP-Seq n confirming: | 12466 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACAGATTGCCTTGACTGC |
| Suggested primer 2: | TCTTCAGCAGCTCTTCCTCC |