| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146978 |
| Chromosome: | chromosome 7 |
| Location: | 2544109 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329800 | HSFL | Similar to heat shock factor binding protein 1; (1 of 1) PF06825 - Heat shock factor binding protein 1 (HSBP1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCGGTCTTCTGGAAGGCTAGCAGGCAA |
| Internal bar code: | GGCAAAGGGATTCCCACGAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 834 |
| LEAP-Seq percent confirming: | 99.7235 |
| LEAP-Seq n confirming: | 2164 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGTCAGAACCCCGTGCT |
| Suggested primer 2: | TTCTCCCCGTCAACGTACTC |