| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.147020 |
| Chromosome: | chromosome 16 |
| Location: | 396696 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693500 | FAP40,ISG1,ISG-C1 | Hydroxyproline-rich Flagellar Associated Protein 40; (1 of 5) PTHR16631:SF9 - GLUCAN 1,3-BETA-GLUCOSIDASE | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGTACCTTCGGCAGCACGCTTGCTCGT |
| Internal bar code: | TTTCTCTGCTGAGCTCCTGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 955 |
| LEAP-Seq percent confirming: | 97.9849 |
| LEAP-Seq n confirming: | 389 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTACCATCATGCTATGGG |
| Suggested primer 2: | CGAAGCTCTCCACAACATCA |