| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147026 |
| Chromosome: | chromosome 13 |
| Location: | 2591936 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581150 | NAT30 | (1 of 36) PF00583 - Acetyltransferase (GNAT) family (Acetyltransf_1); N-acetyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTACTGCCGCCGTTGCCGCTGCTGCCAC |
| Internal bar code: | TGCGTATAGGCATGCGGTGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 50.7053 |
| LEAP-Seq n confirming: | 1330 |
| LEAP-Seq n nonconfirming: | 1293 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGGACACCTGGCAGTAA |
| Suggested primer 2: | ATGAGTCCATCTGGCTCCAC |