| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.147062 |
| Chromosome: | chromosome 10 |
| Location: | 4983106 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455231 | CSR4 | Carbohydrate sulfotransferase-related 4; (1 of 1) 2.8.2.23 - [Heparan sulfate]-glucosamine 3-sulfotransferase 1 / Heparin-glucosamine 3-O-sulfotransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGGGCCCTCCCTTCGCCGGCAAGCCAT |
| Internal bar code: | CGCGATTTCTGACTACAATGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 115 |
| LEAP-Seq percent confirming: | 98.6842 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCCGTGTAGCAGCCAACT |
| Suggested primer 2: | GGGGGAGGGGTTGAGTATTA |