| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.147096 |
| Chromosome: | chromosome 3 |
| Location: | 1034424 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g148500 | PWR6 | (1 of 14) PF04720 - PDDEXK-like family of unknown function (PDDEXK_6); PWR motif protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAATGCTGTCATTCATTCATGCCGCAAG |
| Internal bar code: | ATTCATAGCATCGGTCACTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 857 |
| LEAP-Seq percent confirming: | 99.7973 |
| LEAP-Seq n confirming: | 4431 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTGATTTTCCGAGCATAA |
| Suggested primer 2: | CTGTGTCACCTTGGGTGATG |