| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.147099 |
| Chromosome: | chromosome 16 |
| Location: | 1906145 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g655950 | TRP2 | Transient receptor potential ion channel protein; (1 of 3) IPR002110//IPR005821//IPR020683 - Ankyrin repeat // Ion transport domain // Ankyrin repeat-containing domain | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCATGAAGAACGGCACAGGCAGTCAGAA |
| Internal bar code: | AATACGGGTCCCCTTTCTATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 805 |
| LEAP-Seq percent confirming: | 98.4925 |
| LEAP-Seq n confirming: | 980 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTGCGACTGTCTATGAG |
| Suggested primer 2: | GAAGTTCAGATGAGCACGCA |