| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147125 |
| Chromosome: | chromosome 10 |
| Location: | 1668001 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429880 | CGL156 | DNA binding protein; (1 of 1) IPR001606//IPR001965//IPR003754//IPR011011//IPR019787 - ARID DNA-binding domain // Zinc finger, PHD-type // Tetrapyrrole biosynthesis, uroporphyrinogen III synthase // Zinc finger, FYVE/PHD-type // Zinc finger, PHD-finger | CDS|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCGCCGGCGCGGCCGGAAATGCATGG |
| Internal bar code: | CCTCCGCGCTAACGAGGCAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 251 |
| LEAP-Seq percent confirming: | 73.2429 |
| LEAP-Seq n confirming: | 1511 |
| LEAP-Seq n nonconfirming: | 552 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCACATGTATGGATTCAG |
| Suggested primer 2: | GCAGTCAAGAGTCCAGAGGG |