| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147405 |
| Chromosome: | chromosome 10 |
| Location: | 923272 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424500 | CPK4 | (1 of 1) K00852 - ribokinase (rbsK, RBKS); putative carbohydrate kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAGCCTCCCCTCCACCTGGGTCTCAGAA |
| Internal bar code: | GGTAAGGTTTGGTGCGGGCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 372 |
| LEAP-Seq percent confirming: | 99.8986 |
| LEAP-Seq n confirming: | 1970 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCACCATTCCCTGTCTA |
| Suggested primer 2: | TGCTTTAGCTCGGTGTCCTT |