| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147507 |
| Chromosome: | chromosome 17 |
| Location: | 4432623 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731850 | SDR29 | Short-chain dehydrogenase/reductase; (1 of 1) 1.3.1.34 - 2,4-dienoyl-CoA reductase (NADPH) / 4-enoyl-CoA reductase (NADPH) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGCAAGCTGTGGCGGGGGGAATTGGAA |
| Internal bar code: | TCTAAGCGTCAGTCGTGGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 444 |
| LEAP-Seq percent confirming: | 99.5681 |
| LEAP-Seq n confirming: | 2075 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCAGTACATCCTGACGCC |
| Suggested primer 2: | AGGGTTCTGAGACAGCAGGA |