| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.147535 |
| Chromosome: | chromosome 6 |
| Location: | 5008477 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280100 | (1 of 1) K08371 - cytochrome b-561 domain containing protein 2 (CYB561D2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGGAACCTCCCACTCTGCACCTGCCTG |
| Internal bar code: | CGTGTGCGACGATCGCGTGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 880 |
| LEAP-Seq percent confirming: | 98.4979 |
| LEAP-Seq n confirming: | 459 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAAGGGGTCCACAAGTC |
| Suggested primer 2: | AACCATGTCGGCGATTCTAC |