Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.147541 |
Chromosome: | chromosome 1 |
Location: | 595636 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g003463 | (1 of 1) K08735 - DNA mismatch repair protein MSH2 (MSH2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTTTCTTTACCTTCACGCACATGCACA |
Internal bar code: | TGTGCATTACTGCCTTATGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 527 |
LEAP-Seq percent confirming: | 91.8634 |
LEAP-Seq n confirming: | 1479 |
LEAP-Seq n nonconfirming: | 131 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGTGGTCGCAACACATAC |
Suggested primer 2: | ATGTGTAGGGCTACAACCGC |