| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.147603 |
| Chromosome: | chromosome 9 |
| Location: | 5496378 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400367 | RCL1 | RNA terminal 3' phosphate cyclase; (1 of 1) K11108 - RNA 3'-terminal phosphate cyclase-like protein (RCL1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTTGCTTCATCACAGCCAGAGCGTCCGA |
| Internal bar code: | CGTAGGTTTGGCTCGTTCTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 99.2188 |
| LEAP-Seq n confirming: | 127 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCATCCCTCTCCCACTCT |
| Suggested primer 2: | GCGACTGGAGGTCAGAAGTC |