Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.147711 |
Chromosome: | chromosome 1 |
Location: | 6883461 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g049826 | PHC59 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCCTGCTCGCACTGCGAGCCGTCAAAG |
Internal bar code: | GCGAATGGGTCTGGCCGACTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 260 |
LEAP-Seq percent confirming: | 90.2176 |
LEAP-Seq n confirming: | 10283 |
LEAP-Seq n nonconfirming: | 1115 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGATGCTCCAGTACACCTCG |
Suggested primer 2: | TCACCATAGACCTTCCGAGG |