| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147747 |
| Chromosome: | chromosome 10 |
| Location: | 392357 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g420550 | TSP4,CTPA4,CTPA1 | (1 of 1) IPR004447 - C-terminal-processing peptidase S41A; C-terminal peptidase A | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGGGCCTGAGGGTGGGGACTTGCTAAAA |
| Internal bar code: | CTGAGGTGTCGACGGAGGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 99.6819 |
| LEAP-Seq n confirming: | 940 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAAGTCCCTCAACCTGGA |
| Suggested primer 2: | AAAGATGGACGATGCGAAAC |