Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.147756 |
Chromosome: | chromosome 2 |
Location: | 5928264 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g111700 | EFH1 | (1 of 3) PF13202//PF13499 - EF hand (EF-hand_5) // EF-hand domain pair (EF-hand_7); EF-hand Calcium binding protein | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCTGCTCTCTTCACACGCGCTATTGT |
Internal bar code: | GGCATATGCCCTTACCTGAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 494 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 54 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAACACGATACGCATGTCC |
Suggested primer 2: | TACTTCCCAACACCGTAGCC |