| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.147766 |
| Chromosome: | chromosome 2 |
| Location: | 6729835 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118250 | SWB1 | SWIB domain-containing protein; (1 of 1) K15223 - upstream activation factor subunit UAF30 (UAF30, SPP27) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACTGACAGTGAATGTGGGGGTCAGGAGG |
| Internal bar code: | AATCTACTGTCGCGAGTGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 933 |
| LEAP-Seq percent confirming: | 97.6673 |
| LEAP-Seq n confirming: | 2219 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAACTCAGTGGCACAGCAA |
| Suggested primer 2: | CTGAAACACGCAGACCTGAA |