Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.147788 |
Chromosome: | chromosome 1 |
Location: | 1749530 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g009400 | NSS2 | (1 of 2) PTHR11819//PTHR11819:SF12 - SODIUM/SOLUTE SYMPORTER // HIGH-AFFINITY CHOLINE TRANSPORTER 1; Sodium:solute symporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCATCCACGAACGAGGATTCACCTCCTC |
Internal bar code: | AAGGCCCGTTAAAGGGGGGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 768 |
LEAP-Seq percent confirming: | 99.9189 |
LEAP-Seq n confirming: | 2463 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACCACCTGCACTACCTTT |
Suggested primer 2: | TACAAAAACTACGCCCCGAC |