Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.147823 |
Chromosome: | chromosome 12 |
Location: | 7642649 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554750 | (1 of 5) IPR000626//IPR019956//IPR029071 - Ubiquitin domain // Ubiquitin // Ubiquitin-related domain; Ubiquitin-like Protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGACCCAAAGCTCCGGGTGTCGCAGTT |
Internal bar code: | GATCGTCACGTCCAAAGACTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 994 |
LEAP-Seq percent confirming: | 99.643 |
LEAP-Seq n confirming: | 3070 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTCGTAAGTTTGGACGCC |
Suggested primer 2: | GCGGCAAAAGACCACATATT |