Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.147861 |
Chromosome: | chromosome 12 |
Location: | 3752716 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g515050 | HLM18,SET4 | putative N-methyltransferase; (1 of 1) PTHR13793:SF5 - HISTONE-LYSINE N-METHYLTRANSFERASE ATX4-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCTCCGTATCTAACTCCCCAACCGCCTC |
Internal bar code: | CGATTTTCAAGGAACCTCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 219 |
LEAP-Seq percent confirming: | 99.6132 |
LEAP-Seq n confirming: | 515 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGAAGAGTTGGCCATGTT |
Suggested primer 2: | TCATGCCATTTCTTATGCCA |