| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.147913 |
| Chromosome: | chromosome 3 |
| Location: | 213906 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144344 | (1 of 1) IPR003613//IPR011009//IPR013083//IPR013320 - U box domain // Protein kinase-like domain // Zinc finger, RING/FYVE/PHD-type // Concanavalin A-like lectin/glucanase domain | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGTCATGGCGCGGCGACCTCATTCTTG |
| Internal bar code: | GCTGGCGTACAGACATAGAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 748 |
| LEAP-Seq percent confirming: | 99.8267 |
| LEAP-Seq n confirming: | 576 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGTGTTCAGTACTGGGG |
| Suggested primer 2: | GCTGGCTTGAGAGTGAAACC |