Insertion junction: LMJ.RY0402.147915_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.147915
Chromosome:chromosome_8
Location:4151436
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCCGTACGCTCGTCACCGTACGACAGAGA
Internal bar code:CTGAGGGTCAGCTCGAGGGTAA

Confirmation - LEAP-Seq

LEAP-Seq distance:688
LEAP-Seq percent confirming:99.734
LEAP-Seq n confirming:375
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC