Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.148088 |
Chromosome: | chromosome 17 |
Location: | 1150942 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g704350 | GLOD4 | (1 of 1) PTHR10374//PTHR10374:SF20 - LACTOYLGLUTATHIONE LYASE GLYOXALASE I // GLYOXALASE DOMAIN-CONTAINING PROTEIN 4; Glyoxalase domain containing 4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGCAAGTGGTCCAAAACCATGATCGGG |
Internal bar code: | GGTGCGCTCCCCGATTGTACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 1.10359 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 3943 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGACACGGTAGGTGGTGT |
Suggested primer 2: | CACATCCATGCCGTAACTTG |