| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.148153 |
| Chromosome: | chromosome 11 |
| Location: | 3421065 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480800 | (1 of 1) K14773 - U3 small nucleolar RNA-associated protein 23 (UTP23) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACATGGGGGAATGCTTGAGGTCTGGTCA |
| Internal bar code: | GACATTAATAGGGCAGTCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2 |
| LEAP-Seq percent confirming: | 13.9385 |
| LEAP-Seq n confirming: | 281 |
| LEAP-Seq n nonconfirming: | 1735 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGGTGTCCAAACACGAGG |
| Suggested primer 2: | ACCAACAAAAGGATACCCCC |