Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.148256 |
Chromosome: | chromosome 1 |
Location: | 2447850 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g013700 | ASC1,VDAC1 | (1 of 2) K15040 - voltage-dependent anion channel protein 2 (VDAC2); Voltage-dependent anion-selective channel protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCCTGTGACTCGGGAGGAGGAAGGGG |
Internal bar code: | ATCTTTCCCGTTTCAAGACGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 803 |
LEAP-Seq percent confirming: | 99.7553 |
LEAP-Seq n confirming: | 1223 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGGTTTAGTTTGGGCTGG |
Suggested primer 2: | TACACCACCGGTGACAAGAA |