Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.148521 |
Chromosome: | chromosome 9 |
Location: | 153309 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g386734 | (1 of 2) PTHR31646//PTHR31646:SF1 - FAMILY NOT NAMED // ALPHA-1,2-MANNOSYLTRANSFERASE MNN2 | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATCTGCAAGGATGGGCGCTGCAAGTTGC |
Internal bar code: | AAAGACTCGTGAGACATCCAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 475 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 858 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGACCATTTGGCCACTCTC |
Suggested primer 2: | CGAAGGATAGGTCATGCGAT |