| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.148526 |
| Chromosome: | chromosome 17 |
| Location: | 3501621 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725100 | (1 of 1) PTHR11390:SF20 - DNA TOPOISOMERASE 3-BETA-1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGTACAAACCCAAGCCACACACGCACA |
| Internal bar code: | GTTGGCGCTATTTTGCCGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 59 |
| LEAP-Seq percent confirming: | 2.31204 |
| LEAP-Seq n confirming: | 516 |
| LEAP-Seq n nonconfirming: | 21802 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | GGTATGGTTGTGCGAGTGTG |