| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.148547 |
| Chromosome: | chromosome 7 |
| Location: | 2937369 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g332750 | PSL2 | Protein of unknown function; (1 of 19) IPR000225//IPR016024 - Armadillo // Armadillo-type fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTTTCAACCACACGCCCACGCCTCCATG |
| Internal bar code: | TGTGAGTAAGCGGTACTTGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 550 |
| LEAP-Seq percent confirming: | 99.9245 |
| LEAP-Seq n confirming: | 1323 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGTCCAGCTGCATCTTT |
| Suggested primer 2: | GATTGTGGCTCTGGGTGAGT |