| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.148573 |
| Chromosome: | chromosome 12 |
| Location: | 3120232 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g499850 | CNK7 | NimA-related protein kinase; (1 of 15) K08857 - NIMA (never in mitosis gene a)-related kinase [EC:2.7.11.1] (NEK) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAACATGCGTGTGTGAGCTGCGTGTAAA |
| Internal bar code: | CAAGCCGCCAAAAATGAGGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 99.5798 |
| LEAP-Seq n confirming: | 1422 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGCGTGCAGTCAAACTT |
| Suggested primer 2: | TCCGTAGTACCCACCTCGAC |