| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.148773 |
| Chromosome: | chromosome 13 |
| Location: | 2586858 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581050 | GT90F46,GT90-46 | (1 of 11) 2.4.2.26 - Protein xylosyltransferase / Uridine diphosphoxylose-protein xylosyltransferase; GT90 family protein 46 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATCGTCGCTCACGGCCTCCCGCCTCTCC |
| Internal bar code: | ACACTGATTGTTGGTCGCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 916 |
| LEAP-Seq percent confirming: | 97.3207 |
| LEAP-Seq n confirming: | 2252 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTACAGACGGGGCATTT |
| Suggested primer 2: | CAAGAAATCCAGCGGATCAT |