| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.148805 |
| Chromosome: | chromosome 9 |
| Location: | 5908531 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402515 | AMX1 | (1 of 2) 1.4.3.21 - Primary-amine oxidase / Copper amine oxidase; Copper amine oxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGAAGAAGCCGGCGGGCTTGAGGGTGA |
| Internal bar code: | AATCAGTTTCGCTTCTTTCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 405 |
| LEAP-Seq percent confirming: | 99.4501 |
| LEAP-Seq n confirming: | 1266 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATGGTGACTGGTATGGGG |
| Suggested primer 2: | CGACAAGGAGCCAAGTAAGC |